![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_K3426000
Cellulose-Binding Modules of Type 2a (CBM2a) Fused to mRFP1
CBM2a is a binding domain isolated from Cellulomonas fimi xylanase Family 10A. Normally this protein domain would direct the xylanase to the surface of xylan/cellulose. We aim for this part to be used as a of surface attachment to cellulose, aiding in the disruption of hydrogen bonding and decreasing overall crystallinity. Fusion to the mRFP will allow for detection when CBM2a attaches to the surface of cellulose. Reference: McLean et al, Protein Eng. 2000
Usage and Biology
The binding of carbohydrate binding modules (CBMs) decreases the crystallinity of cellulose. For our project, we are using cellulose as a base for a biodegradable plastic mulch used in agriculture. Cellulose is rigid and tough to use due to its high crystallinity level. In order to produce our plastic, the first step is to use CBMs to decrease the rigidity of the cellulose fibril structure in order to add in a plasticizing agent, or a compound that adds elasticity and flexibility to a product. Our usage of CBMs comes in the form of CBM2a (cellulose binding module family 2a) that has a lower binding affinity to cellulose
Construction
The CBM2a-mRFP gene block was large (over 2kb), so it was split into 2 gene blocks: CBM2a with N and C linkers, and mRFP. We amplified both the pET-28a(+) backbone and gene blocks using primers containing BsaI recognition sites. The CBM2a and mRFP gene blocks were then cloned this gene block into pET28a(+) plasmid designed for Golden Gate Assembly using BsaI recognition sites to achieve scarless cloning.
Figure 1. PCR Amplification of CBM2a and mRFP Agarose gel electrophoresis image of CBM2a and mRFP PCR products after amplification with primers containing BsaI sites. Lane 0: 1kb plus ladder. Lane 2: mRFP PCR product (.6kb). Lane 5: CBM2a (1.7kb).
Sequence and Features
CBM2a Forward Primer:CACCACAGGTCTCGTCGCATGAATGCTACGCCAACTAAGG
CBM2a Reverse Primer:CACCACAGGTCTCGATCGTCCAATGATGGAGGAATGG
mRFP Forward Primer:CACCACAGGTCTCGCGATCCGATGGCTTCCTCCGAAG
mRFP Reverse Primer: CACCACAGGTCTCGGGTGCTAAGCACCGGTGGAGTGAC
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 361
Illegal PstI site found at 910 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 361
Illegal PstI site found at 910 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 361
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 361
Illegal PstI site found at 910 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 361
Illegal PstI site found at 910
Illegal AgeI site found at 2247
Illegal AgeI site found at 2359 - 1000COMPATIBLE WITH RFC[1000]
None |